| Internal ID | 17668295 | Source Database | TransTermHP TERM 609 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 609
|
| Sequence |
CCCCGCCAAGGTTTGCCTTGGCGGGG Look for more occurrences |
| Start | 2015785 |
| End | 2015810 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas putida GB-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCGGTTGTACGCGCG(5' tail) CCCCGCCAAGG(5' stem) TTTG(loop) CCTTGGCGGGG(3' stem) TTTGTTTTTTCAGCC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|