| Internal ID | 17668535 | Source Database | TransTermHP TERM 1036 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1036
|
| Sequence |
GCCCGCTCAATCGAGCGGGC Look for more occurrences |
| Start | 4422392 |
| End | 4422411 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida GB-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCAGAAAAACAAAAA(5' tail) GCCCGCTC(5' stem) GATT(loop) GAGCGGGC(3' stem) TTCTTGATGGGATAT(3' tail). Confidence: 100. opp_overlap 4422392, overlap 4422386 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|