Internal ID | 17669239 | Source Database | TransTermHP TERM 553 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 553
|
Sequence |
CGCCCCGACAAGTCGGGGCG Look for more occurrences |
Start | 2160786 |
End | 2160805 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas brassicacearum subsp. brassicacearum NFM421 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AGCCGCTTGTGAAAA(5' tail) CGCCCCGA(5' stem) CTTG(loop) TCGGGGCG(3' stem) TTTTTGTATCTGAAG(3' tail). Confidence: 100. opp_overlap 2160786 2160780 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|