| Internal ID | 17671159 | Source Database | TransTermHP TERM 403 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 403
|
| Sequence |
GAAGCCGGGCATTGCCCGGCTTC Look for more occurrences |
| Start | 1607522 |
| End | 1607544 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas mendocina NK-01 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AGATGTGCACACGAA(5' tail) GAAGCCGGGC(5' stem) AAT(loop) GCCCGGCTTC(3' stem) TCTTTGCCTGCGTAA(3' tail). Confidence: 95. opp_overlap 1607520 1607522 1607525, overlap 1607525 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|