| Internal ID | 17671492 | Source Database | TransTermHP TERM 903 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 903
|
| Sequence |
CAAAGCCCTCCAAAAGAGGGCTTTG Look for more occurrences |
| Start | 3494177 |
| End | 3494201 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas mendocina NK-01 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGCTCGCAAAAACAA(5' tail) CAAAGCCCTC(5' stem) CAAAA(loop) GAGGGCTTTG(3' stem) TTGTTTCCGCTCGCC(3' tail). Confidence: 95. opp_overlap 3494174 3494181, overlap 3494174 3494181 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|