Internal ID | 17671832 | Source Database | TransTermHP TERM 1425 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1425
|
Sequence |
CGCCCGGGCAATTGCCCGGGCG Look for more occurrences |
Start | 5285733 |
End | 5285754 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas mendocina NK-01 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | ACCAACAAACCAAAA(5' tail) CGCCCGGGC(5' stem) AATT(loop) GCCCGGGCG(3' stem) TTTTGTTTGCTGCAG(3' tail). Confidence: 100. opp_overlap 5285728 5285727 5285723 5285733, overlap 5285728 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|