| Internal ID | 17671982 | Source Database | TransTermHP TERM 183 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 183
|
| Sequence |
GACCCCGGCCCATTGGCCGGGGTC Look for more occurrences |
| Start | 791581 |
| End | 791604 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas fluorescens F113 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGACAGGCAAAAAAA(5' tail) GACCCCGGCC(5' stem) AATG(loop) GGCCGGGGTC(3' stem) TTTTCTACACCGCTT(3' tail). Confidence: 100. opp_overlap 791581 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|