Internal ID | 17672786 | Source Database | TransTermHP TERM 1290 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1290
|
Sequence |
GCCCTGATCGAAAGATCAGGGC Look for more occurrences |
Start | 6254465 |
End | 6254486 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas fluorescens F113 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | ACGCGGCACAAAAAA(5' tail) GCCCTGATC(5' stem) TTTC(loop) GATCAGGGC(3' stem) TTTTTTCATTTGCAA(3' tail). Confidence: 100. opp_overlap 6254465 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|