Internal ID | 17673904 | Source Database | TransTermHP TERM 60 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 60
|
Sequence |
CCGCCCGGGCAATGCCCGGGCGG Look for more occurrences |
Start | 238088 |
End | 238110 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas putida S16 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCCCCAGTAAGAAAA(5' tail) CCGCCCGGGC(5' stem) AAT(loop) GCCCGGGCGG(3' stem) TTTTTTTTCGCCTGG(3' tail). Confidence: 100. opp_overlap 238088 238083 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|