| Internal ID | 17674098 | Source Database | TransTermHP TERM 371 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 371
|
| Sequence |
GAGGGCACGGGCTTCGTGCCCTC Look for more occurrences |
| Start | 1231349 |
| End | 1231371 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida S16 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCCAAATGCTAAAA(5' tail) GAGGGCACGA(5' stem) AGC(loop) CCGTGCCCTC(3' stem) CAGCGCGGCGCCTGC(3' tail). Confidence: 100. overlap 1231360 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|