| Internal ID | 17674380 | Source Database | TransTermHP TERM 856 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 856
|
| Sequence |
GCCCCGCAGGCCTTGGTCCGCGGGGC Look for more occurrences |
| Start | 3244260 |
| End | 3244285 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas putida S16 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTCCCCCAACCGTTT(5' tail) GCCCCGCAGGC(5' stem) CTTG(loop) GTCCGCGGGGC(3' stem) TTTTTTATGCTGATT(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|