| Internal ID | 17674900 | Source Database | TransTermHP TERM 40 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 40
|
| Sequence |
CCCGTTGCAGGTGACTGCAGCGGG Look for more occurrences |
| Start | 190575 |
| End | 190598 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida BIRD-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TCGGGCAATAAAAAA(5' tail) CCCGCTGCAG(5' stem) TCAC(loop) CTGCAACGGG(3' stem) TTTGAGGAATTCACG(3' tail). Confidence: 100. opp_overlap 190575 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|