| Internal ID | 17674901 | Source Database | TransTermHP TERM 41 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 41
|
| Sequence |
GCCCCGGTCAGAATCTGCCGGGGC Look for more occurrences |
| Start | 192853 |
| End | 192876 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida BIRD-1 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCAATAAAAGAAAA(5' tail) GCCCCGG-CAG(5' stem) ATT(loop) CTGACCGGGGC(3' stem) TTCCTTTATATCAGC(3' tail). Confidence: 100. gap 1, opp_overlap 192849 192853 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|