| Internal ID | 17678219 | Source Database | TransTermHP TERM 998 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 998
|
| Sequence |
GGGGTGTTCGCGCAAGCGGCACCCC Look for more occurrences |
| Start | 4437981 |
| End | 4438005 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri ATCC 17588 = LMG 11199 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GGTGATCGTTGAGGT(5' tail) GGGGTGTTCGC(5' stem) GCAA(loop) GCGG-CACCCC(3' stem) TTTTTCTTTGGTTCT(3' tail). Confidence: 100. gap 1 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|