| Internal ID | 17678903 | Source Database | TransTermHP TERM 46 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 46
|
| Sequence |
CCCCGGCCACATTCCTGTGGCCGGGG Look for more occurrences |
| Start | 209150 |
| End | 209175 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri CCUG 29243 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGATCAAAAAAGAAA(5' tail) CCCCGGCCACA(5' stem) TTCC(loop) TGTGGCCGGGG(3' stem) GTTTTCTTTGCAGCG(3' tail). Confidence: 100. opp_overlap 209146 209150, overlap 209149 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|