Internal ID | 17679499 | Source Database | TransTermHP TERM 986 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 986
|
Sequence |
GGCCGGGCGGCAACCGCCCGGCC Look for more occurrences |
Start | 4479999 |
End | 4480021 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas stutzeri CCUG 29243 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CTGAAGCTGCCGAAA(5' tail) GGCCGGGCGG(5' stem) CAA(loop) CCGCCCGGCC(3' stem) TTTGTTCATCCGCGA(3' tail). Confidence: 100. opp_overlap 4479999 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|