Internal ID | 17679658 | Source Database | TransTermHP TERM 229 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 229
|
Sequence |
GGGTTAGCGAAGGCTAGCCC Look for more occurrences |
Start | 1190450 |
End | 1190469 |
Strand | + |
Genomic Context | Located within gene [PSJM300_05450] |
Replicon | Pseudomonas stutzeri DSM 10701 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | ACCAATGAAATCAAA(5' tail) GGGTTAGC(5' stem) GAAG(loop) GCTAGCCC(3' stem) TTTTTCATTTGGGGC(3' tail). Confidence: 100. opp_overlap 1190450 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|