| Internal ID | 17679738 | Source Database | TransTermHP TERM 359 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 359
|
| Sequence |
GACGGGCCTCATGGCCCGTC Look for more occurrences |
| Start | 1637878 |
| End | 1637897 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas stutzeri DSM 10701 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGTGACCGAAAGAA(5' tail) GACGGGCC(5' stem) TCAT(loop) GGCCCGTC(3' stem) TTGCTTTTATGAGCC(3' tail). Confidence: 95. opp_overlap 1637863 1637878, overlap 1637875 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|