Internal ID | 17679796 | Source Database | TransTermHP TERM 452 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 452
|
Sequence |
GGTGCCCCGCCTGTCGCGGGGCACC Look for more occurrences |
Start | 2282470 |
End | 2282494 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas stutzeri DSM 10701 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CGAATGACGGCCAAC(5' tail) GGTGCCCCGC(5' stem) CTGTC(loop) GCGGGGCACC(3' stem) TTCATGTCGTGCGGG(3' tail). Confidence: 100. opp_overlap 2282462 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|