Internal ID | 17679899 | Source Database | TransTermHP TERM 625 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 625
|
Sequence |
GGGCAAAGGCGAAAGCCTTTGCCC Look for more occurrences |
Start | 3166149 |
End | 3166172 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas stutzeri DSM 10701 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | AACCGTTGTACCGAA(5' tail) GGGCAAAGGC(5' stem) GAAA(loop) GCCTTTGCCC(3' stem) TTTTTATTTGCCTCG(3' tail). Confidence: 100. opp_overlap 3166149 3166156 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|