| Internal ID | 17680963 | Source Database | TransTermHP TERM 150 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 150
|
| Sequence |
ACCCCGTCGATTGGCGGGGC Look for more occurrences |
| Start | 507253 |
| End | 507272 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida HB3267, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGAGGCAAAAAAAA(5' tail) GCCCCGCC(5' stem) AATC(loop) GACGGGGT(3' stem) TGAGGTACGAGCGTG(3' tail). Confidence: 100. overlap 507254 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|