| Internal ID | 17680970 | Source Database | TransTermHP TERM 161 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 161
|
| Sequence |
CCCGTCTGCCTTCACCGGCAGGCGGG Look for more occurrences |
| Start | 548544 |
| End | 548569 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas putida HB3267, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCGCTGTACACGAAA(5' tail) CCCGTCTGCC(5' stem) TTCACC(loop) GGCAGGCGGG(3' stem) TTTTTTCATTCTGCG(3' tail). Confidence: 100. opp_overlap 548544 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|