| Internal ID | 17681629 | Source Database | TransTermHP TERM 1303 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1303
|
| Sequence |
TCGAGCGCCGCGCGGGCGGCGCTCGA Look for more occurrences |
| Start | 4979108 |
| End | 4979133 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas putida HB3267, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTAGTACCCGTAAGA(5' tail) TCGAGCGCCGC(5' stem) CCGC(loop) GCGGCGCTCGA(3' stem) TCTCACAGGCACTAG(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|