Internal ID | 17683949 | Source Database | TransTermHP TERM 294 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 294
|
Sequence |
GGCCCGCTGAGCAGCGGGCC Look for more occurrences |
Start | 1179960 |
End | 1179979 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas aeruginosa RP73, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCGCGCCAACGAAAA(5' tail) GGCCCGCT(5' stem) GCTC(loop) AGCGGGCC(3' stem) TTCGGATGCCGGCGC(3' tail). Confidence: 100. |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|