| Internal ID | 17685495 | Source Database | TransTermHP TERM 110 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 110
|
| Sequence |
ACCCCGCCAATTTGGCGGGGC Look for more occurrences |
| Start | 447962 |
| End | 447982 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. UW4 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CTTCAGGCAAAAAAA(5' tail) GCCCCGCCA(5' stem) AAT(loop) TGGCGGGGT(3' stem) TGAGGTACGAGCGTG(3' tail). Confidence: 100. overlap 447963 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|