Internal ID | 17685667 | Source Database | TransTermHP TERM 340 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 340
|
Sequence |
CCCGATCAGTCACCTGATCGGG Look for more occurrences |
Start | 1383663 |
End | 1383684 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas sp. UW4 chromosome, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | CCGGATAAACAAAAA(5' tail) CCCGATCAG(5' stem) GTGA(loop) CTGATCGGG(3' stem) TTTTTTGTTTTCGCG(3' tail). Confidence: 100. opp_overlap 1383648 1383663, overlap 1383648 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|