| Internal ID | 17685840 | Source Database | TransTermHP TERM 578 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 578
|
| Sequence |
CTTGTAGTGGAATCACTACAAG Look for more occurrences |
| Start | 2565402 |
| End | 2565423 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas sp. UW4 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | AACCTAGAGTGGCTG(5' tail) CTTGTAGTG(5' stem) GAAT(loop) CACTACAAG(3' stem) TTTTTGGTCGATATC(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|