| Internal ID | 17686393 | Source Database | TransTermHP TERM 1321 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1321
|
| Sequence |
GCCCTGATCTTTCGATCAGGGC Look for more occurrences |
| Start | 5699545 |
| End | 5699566 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas sp. UW4 chromosome, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCCGGACATGAAAAA(5' tail) GCCCTGATC(5' stem) GAAA(loop) GATCAGGGC(3' stem) TTTTTTGTTTGCTTG(3' tail). Confidence: 100. opp_overlap 5699545 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|