| Internal ID | 17686499 | Source Database | TransTermHP TERM 8 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 8
|
| Sequence |
GCCGGCTCCTGGAGGGGAGCAGGC Look for more occurrences |
| Start | 49848 |
| End | 49871 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas protegens CHA0, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ACCCCGCAGTAAAAA(5' tail) GCCTGCTCCC(5' stem) CTCC(loop) AGGAGCCGGC(3' stem) TTGCCGGCGAAGCGA(3' tail). Confidence: 95. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|