| Internal ID | 17686766 | Source Database | TransTermHP TERM 382 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 382
|
| Sequence |
CCCCGACCAGTTGCCTGGCCGGGG Look for more occurrences |
| Start | 1473872 |
| End | 1473895 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas protegens CHA0, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TGCTACAAAACAAAA(5' tail) CCCCGGCCAG(5' stem) GCAA(loop) CTGGTCGGGG(3' stem) TTTTGTGTTTTCAGC(3' tail). Confidence: 100. opp_overlap 1473872 1473867 1473865, overlap 1473867 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|