Internal ID | 17687180 | Source Database | TransTermHP TERM 1040 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1040
|
Sequence |
GGCCCGGCGCTTGCGGCGCCGGGCC Look for more occurrences |
Start | 4609539 |
End | 4609563 |
Strand | + |
Genomic Context | |
Replicon | Pseudomonas protegens CHA0, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCCAGGCCAGCCACT(5' tail) GGCCCGGCGCT(5' stem) TGC(loop) GGCGCCGGGCC(3' stem) TGATTCAAGGTTCGC(3' tail). Confidence: 100. overlap 4609561 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|