| Internal ID | 17687544 | Source Database | TransTermHP TERM 1583 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1583
|
| Sequence |
CGCCGACCCTGGGGTCGGCG Look for more occurrences |
| Start | 6557193 |
| End | 6557212 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas protegens CHA0, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATGGCCGACAGCAAA(5' tail) CGCCGACC(5' stem) CCAG(loop) GGTCGGCG(3' stem) TTTTTGTGTGCCCGA(3' tail). Confidence: 100. opp_overlap 6557193 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|