| Internal ID | 17687735 | Source Database | TransTermHP TERM 183 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 183
|
| Sequence |
CCGCTTCCGTCACCGGAAGCGG Look for more occurrences |
| Start | 795713 |
| End | 795734 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas poae RE*1-1-14, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGCGCATAAAAAAA(5' tail) CCGCTTCCG(5' stem) GTGA(loop) CGGAAGCGG(3' stem) TTTTTGATTTACACC(3' tail). Confidence: 100. opp_overlap 795713 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|