| Internal ID | 17688657 | Source Database | TransTermHP TERM 264 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 264
|
| Sequence |
GCGCGGCCCACGGGCCGCGC Look for more occurrences |
| Start | 875028 |
| End | 875047 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CCCCAGGCAAAAAAA(5' tail) GCGCGGCC(5' stem) CGTG(loop) GGCCGCGC(3' stem) AAGGATCGATGTGAG(3' tail). Confidence: 100. |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|