| Internal ID | 17688839 | Source Database | TransTermHP TERM 532 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 532
|
| Sequence |
GAGCCCCGCTGATGCGGGGCTC Look for more occurrences |
| Start | 1702886 |
| End | 1702907 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | TTCCATCCAAATGAA(5' tail) GAGCCCCGC(5' stem) ATCA(loop) GCGGGGCTC(3' stem) TTGCGGATCAGACCA(3' tail). Confidence: 100. opp_overlap 1702888, overlap 1702882 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|