| Internal ID | 17689190 | Source Database | TransTermHP TERM 1075 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1075
|
| Sequence |
GGGCGGACACCATCGGTGTCCGCCC Look for more occurrences |
| Start | 3565559 |
| End | 3565583 |
| Strand | + |
| Genomic Context | |
| Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | GCGAGCAAGGAAAAA(5' tail) GGGCGGACACC(5' stem) ATC(loop) GGTGTCCGCCC(3' stem) TTTTTTTGCATTTCC(3' tail). Confidence: 100. opp_overlap 3565559 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|