Internal ID | 17689191 | Source Database | TransTermHP TERM 1076 |
Feature Type | terminator |
Name |
Rho-independent transcription terminator TERM 1076
|
Sequence |
GGGCGGACACCGATGGTGTCCGCCC Look for more occurrences |
Start | 3565559 |
End | 3565583 |
Strand | - |
Genomic Context | |
Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
Additional Comments | GCGAGCAAGGAAAAA(5' tail) GGGCGGACACC(5' stem) ATC(loop) GGTGTCCGCCC(3' stem) TTTTTTTGCATTTCC(3' tail). Confidence: 100. opp_overlap 3565559 |
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|