| Internal ID | 17689526 | Source Database | TransTermHP TERM 1580 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1580
|
| Sequence |
GCGCGCCGGCCCTGAGCCGGCGCGC Look for more occurrences |
| Start | 5101364 |
| End | 5101388 |
| Strand | - |
| Genomic Context | |
| Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | CGAACGGAGAAAGAC(5' tail) GCGCGCCGGC(5' stem) TCAGG(loop) GCCGGCGCGC(3' stem) AGGGTGTTTCAGAGG(3' tail). Confidence: 95. opp_overlap 5101362 5101361 5101359, overlap 5101363 5101361 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|