| Internal ID | 17689644 | Source Database | TransTermHP TERM 1752 |
| Feature Type | terminator |
| Name |
Rho-independent transcription terminator TERM 1752
|
| Sequence |
GGCCGGCGCACTCAGCGCCGGCC Look for more occurrences |
| Start | 5566802 |
| End | 5566824 |
| Strand | + |
| Genomic Context | Located within gene [H681_24810] |
| Replicon | Pseudomonas denitrificans ATCC 13867, complete genome. |
| Evidence |
ECO:0000246
computational combinatorial evidence used in automatic assertion
|
| Additional Comments | ATCATTGAGCCCTCC(5' tail) GGCCGGCGC(5' stem) ACTCA(loop) GCGCCGGCC(3' stem) ATTTTCCTCCAGCAG(3' tail). Confidence: 90. overlap 5566801 |
|
Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake.
Kingsford CL, Ayanbule K, Salzberg SL
Genome Biol. 2007 ;8(2):R22
PubMed ID: 17313685
|